Logo

AskSia

Plus

CENTRAL DOGMA OF MOLECULAR BIOLOGY The components of DNA Complete each stateme...
Apr 22, 2024
CENTRAL DOGMA OF MOLECULAR BIOLOGY The components of DNA Complete each statement by writing in the correct word or words. 1. The building blocks of DNA are called \qquad 2. Nucleotides in DNA are made of three basic components: a sugar called \qquad , a group, and a \qquad 3. DNA contains four kinds of nitrogenous bases: \qquad , and \qquad 4. In DNA, the order of the nitrogenous bases is the sequence to make a \qquad 5. A specific sequence of nitrogen bases (segment of DNA) that codes for a protein is known as \qquad Complete the table by estimating the percentages of each based on Chargaff's rules. Remember: A=T,C=G\mathrm{A}=\mathrm{T}, \mathrm{C}=\mathrm{G} \begin{tabular}{|c|c|c|c|c|} \hline DNA sample & \begin{tabular}{c} Percent of \\ adenine \end{tabular} & \begin{tabular}{c} Percent of \\ thymine \end{tabular} & \begin{tabular}{c} Percent of \\ guanine \end{tabular} & \begin{tabular}{c} Percent of \\ cytosine \end{tabular} \\ \hline 1 & 31.5 & & & \\ \hline 2 & & 30 & 20 & \\ \hline 3 & & & & 17 \\ \hline \end{tabular} \begin{tabular}{|l|l|} \hline \multicolumn{1}{|c|}{ ENZYME } & \\ \hline 1. helicase & \\ \hline 2. SSBP & \\ \hline 3. Primase & \\ \hline 4. DNA Polymerase & \\ \hline 5. Exonuclease & \\ \hline 6. ligase & \\ \hline \end{tabular} Here is the beginning of a protein-encoding gene sequence. 5'... TACCCGTACGCAGT G CGTACAGGTCCAT T ...3, 3'... ATGGGCATGCGTCACGCATGTCCAGGTAA ...5, a. Give the RNA transcript that would be transcribed off of the bottom strand: b. Translate this RNA sequence into a protein sequence. c. Give the RNA transcript that would be transcribed off of the top strand: d. Translate this RNA sequence into a protein sequence.
Answer
The building blocks of DNA are called nucleotides.
Solution
Key Concept
DNA Structure
Explanation
DNA is composed of units called nucleotides, each consisting of a sugar, a phosphate group, and a nitrogenous base.
Answer
Nucleotides in DNA are made of three basic components: a sugar called deoxyribose, a phosphate group, and a nitrogenous base.
Solution
Key Concept
Nucleotide Structure
Explanation
Each nucleotide in DNA is composed of a deoxyribose sugar, a phosphate group, and one of four nitrogenous bases.
Answer
DNA contains four kinds of nitrogenous bases: adenine (A), thymine (T), guanine (G), and cytosine (C).
Solution
Key Concept
Nitrogenous Bases in DNA
Explanation
The four nitrogenous bases in DNA are adenine, thymine, guanine, and cytosine, which pair A-T and G-C according to Chargaff's rules.
Answer
In DNA, the order of the nitrogenous bases is the sequence to make a gene.
Solution
Key Concept
Gene Sequence
Explanation
The specific order of nitrogenous bases in DNA determines the sequence of a gene, which can be transcribed and translated to produce a protein.
Answer
A specific sequence of nitrogen bases (segment of DNA) that codes for a protein is known as a gene.
Solution
Key Concept
Gene Definition
Explanation
A gene is a specific sequence of nitrogenous bases in DNA that provides the instructions for making a particular protein.
Answer
For DNA sample 1: Percent of thymine = 31.5%, Percent of guanine = 18.5%, Percent of cytosine = 18.5%. For DNA sample 2: Percent of adenine = 30%, Percent of cytosine = 20%, Percent of guanine = 20%. For DNA sample 3: Percent of guanine = 17%, Percent of adenine = 17%, Percent of thymine = 17%.
Solution
Key Concept
Chargaff's Rules
Explanation
Chargaff's rules state that in DNA, the amount of adenine (A) equals the amount of thymine (T), and the amount of guanine (G) equals the amount of cytosine (C).
Answer
The functions of the enzymes are as follows: 1. Helicase - Unwinds the DNA double helix. 2. SSBP (Single-Strand Binding Proteins) - Stabilizes single-stranded DNA. 3. Primase - Synthesizes RNA primers. 4. DNA Polymerase - Synthesizes DNA by adding nucleotides to a growing chain and proofreading. 5. Exonuclease - Removes RNA primers and repairs DNA. 6. Ligase - Joins Okazaki fragments and seals nicks in the DNA backbone.
Solution
Key Concept
DNA Replication Enzymes
Explanation
Each enzyme has a specific role in the process of DNA replication, ensuring accurate and efficient duplication of the genetic material.
Answer
a. The RNA transcript from the bottom strand is 5'... UACCCGUACGCAGU ...3'. b. The translated protein sequence is Tyr-Pro-Tyr-Ala-Val. c. The RNA transcript from the top strand is 5'... AUGGGCAUGCGUCAC ...3'. d. The translated protein sequence is Met-Gly-Met-Arg-His.
Solution
i
To translate the RNA sequence into a protein sequence, we use the genetic code to find the corresponding amino acids for each codon. - The translated protein sequence from the RNA transcript is Tyr-Pro-Tyr-Ala-Val
j
To transcribe the RNA from the top strand, we use the complementary RNA bases to the DNA bases on the top strand, replacing thymine (T) with uracil (U) for RNA. - The RNA transcript from the top strand is 5'... AUGGGCAUGCGUCAC ...3'
k
To translate the RNA sequence into a protein sequence, we use the genetic code to find the corresponding amino acids for each codon. - The translated protein sequence from the RNA transcript is Met-Gly-Met-Arg-His
Key Concept
Transcription and Translation
Explanation
Transcription is the process of creating an RNA copy of a DNA sequence, and translation is the process of synthesizing a protein from an RNA transcript using the genetic code.
© 2023 AskSia.AI all rights reserved